Download for Windows Premium
Advertising
gene code
Gencode m
Gene-Code
Gen-Code
It's in my gene code or something.
Das liegt in meinem Gencode oder so.
This is an extremely dynamic system, not a rigid blueprint, as it is codified in the actual gene code.
Dabei handelt es sich um ein äußerst dynamisches System, keinen starren Bauplan, wie er im eigentlichen Gencode festgeschrieben ist.
We claim to be cracking the gene code, but we still can't cure a cold with man-made substances!!
Wir behaupten, den Gencode zu knacken, aber wir können eine Erkältung mit künstlichen Substanzen nicht heilen!!
There were 28 synonyms and 85 changes in the gene code which influence the primary sequence of the protein.
Es zeigten sich 28 Synonyme und 85 Veränderungen im Gencode welche Einfluss auf die Primärsequenz des Proteins haben.
is 0.004 percent of gene code.
beträgt 0,004 Prozent des Gencodes.
The fact that out of three billion base pair chemicals in the Human gene code only sixty million are active and that we use only one fifth of our brain capacity, are manifest signs that point to Human genetic modification.
Die Tatsache, dass von den drei Milliarden Basenpaar-Chemikalien im menschlichen Gencode nur 60 Millionen aktiv sind und wir nur ein Fünftel unserer Gehirnkapazität nutzen, sind manifeste Zeichen, die auf die menschliche genetische Veränderung hindeuten.
VISUAL DNA translates the gene code of different organisms into graphic pattern
VISUAL DNA übersetzt den Gencode verschiedener Lebewesen in graphische Muster.
The difference between humans and Neanderthal is 0.004 percent of gene code.
Der Unterschied zwischen Menschen und Neandertalern beträgt 0,004 Prozent des Gencodes.
The difference between humans and Neanderthal is 0.004 percent of gene code.
Der Unterschied zwischen Menschen und Neandertalern beträgt 0,004 % des Gencodes.
BYERS: It's a gene code we've seen before, detected in Scully's blood after her abduction.
Byers: Das ist ein Gencode, den wir schon mal gesehen haben, und zwar in Scullys Blut, nach ihrer Entführung.
So the four DNA bases are known as A, C, G and T, and if someone was to write out a gene code it would look something like this: AAGTCCTGACTGGGACCTTGAGA CCTAG.
So sind die vier DNA-Basen als A, C, G und T bekannt. Falls also jemand einen Gencode ausschreiben müsste, würde es so ähnlich ausschauen wie: AAGTCCTGACTGGGACCTTGAGA CCTAG.
There are many aspects of the gene code of your species that have not been expressed, though they do become expressed in some individuals.
Es gibt viele Aspekte des genetischen Codes Eurer Rasse, die noch nicht ausgedrückt worden sind, obwohl dies bei einigen Individuen doch geschieht.
We program the "gene code" of buildings
Wir programmieren den Gen-Code von Gebäuden
No results found for this meaning.

Synonyms and analogies of "gene code" in English

Word & Expression of the day
Image of the day
axe: tool with a heavy bladed head mounted across a handle
Reveal the word
Advertising

Results: 19. Exact: 19. Elapsed time: 43 ms.

Word index: 1-300, 301-600, 601-900

Expression index: 1-400, 401-800, 801-1200

Phrase index: 1-400, 401-800, 801-1200