Vertaling van "its complementary sequence" in Frans
We konden deze vermelding niet vinden. Er worden benaderende resultaten weergegeven. Controleer je spelling of stel voor deze term aan het woordenboek toe te voegen.
sa séquence complémentaire
When the probe binds to its complementary sequence in the target, the fluorophore and the quencher are held apart, allowing fluorescent emission and detection.
Lorsque la sonde se lie à sa séquence complémentaire dans la cible, le fluorophore et le désactivateur sont mis à l'écart, ce qui permet l'émission et la détection de signaux fluorescents.
The binding of a nucleic acid probe with its complementary sequence in a targeted, single stranded nucleic acid is affected by the secondary and tertiary structure of the target nucleic acid.
La liaison d'une sonde d'acide nucléique avec sa séquence complémentaire dans un acide nucléique-cible à brin unique est affectée par les structures secondaire et tertiaire de l'acide nucléique-cible.
During the annealing of such a primer with the nucleic acid template, the fixed sequence determines where the complete primer binds by binding to its complementary sequence on the nucleic acid template.
Au cours de la renaturation de ladite amorce avec la matrice d'acides nucléiques, la séquence fixe détermine où l'amorce complète se fixe par liaison à sa séquence complémentaire sur la matrice d'acides nucléiques.
This probe is brought into contact with the chromosomes of a mitosis (or interphase nuclei) and will hybridize (bind) specifically at the level of its complementary sequence.
Cette sonde est mise en contact avec les chromosomes d'une mitose (ou de noyaux interphasiques) et va s'hybrider (se fixer) spécifiquement au niveau de sa séquence complémentaire.
providing a set of probes and passing said probes through said matrix under conditions favouring hybridisation of the probes to its complementary sequence in said intact genomic DNA; and
à fournir un ensemble de sondes et à passer ces sondes à travers ladite matrice dans des conditions favorisant l'hybridation desdites sondes à sa séquence complémentaire dans ledit ADN génomique intact et
or any labelled form thereof or any derivative thereof which retains the ability of the 6N-palindrome sequence to anneal or hybridise to its complementary sequence are useful in assay of encephalopathies such as scrapie, BSE or CJD
ou toutes leurs formes marquées ou leurs dérivés, qui gardent la capacité de la séquence 6N-palindrome de s'hybrider avec sa séquence complémentaire, sont utiles dans la détection des encéphalopathies telles que tremblante du mouton, encéphalopathie spongiforme bovine ou maladie de creutzfeld-jakob
an oligonucleotide, 10 -50 nucleotides in length, preferably 10 -35 nucleotides in length, comprising at least a fragment of 10 nucleotides of a sequence selected from the group consisting of: 5'CCAGGGCCCTGGAGGTGCGG -3', or its complementary sequence
un oligonucléotide, 10 à 50 nucléotides en longueur, de préférence entre 10 et 35 nucléotides dans la longueur, comprenant au moins un fragment de 10 nucléotides d'une séquence sélectionnée parmi le groupe constitué de 5'CCAGGGCCCTGGAGGTGCGG -3', ou sa séquence complémentaire
5'(CCCCT CACTG TCCAC CTC TG CC TATAG AGAC) n 3'or its complementary sequence (II)
5'(CCCCT CACTG TCCAC CTC TG CC TATAG AGAC) n 3', ou sa séquence complémentaire II
1 or with its complementary sequence. the invention also concerns a nucleic material and a peptide material and their uses.
1 ou avec son complémentaire, matériel nucléique et matériel peptidique et utilisations.
The probes can hybridize to the nucleotide sequence and/or its complementary sequence of the cytochrome P450 gene to be detected.
Les sondes peuvent s'hybrider avec la séquence nucléotidique et/ou avec la séquence complémentaire du gène cytochrome P450 devant être détecté.
The grafted probes were shown to be available for targethybridization and the material compatible with a chemiluminescent detection of the interactions between theimmobilized single stranded DNA and its complementary sequence in a 100 pM to 200 nM range.
Enfin, le greffage d'oligonucléotides via la chimie des sels d'aryldiazonium a également étéeffectué avec succès et utilisé pour la détection de séquences cibles à des concentrations de 100 pM à 200nM.
Potentieel gevoelige of ongepaste informatie
Er worden alleen voorbeelden gegeven om u te helpen het woord of de woordcombinatie waarop u hebt gezocht, te vertalen. Deze worden niet door ons geselecteerd of gevalideerd en kunnen ongepaste taal bevatten. Wij vragen u melding te maken van voorbeelden die dienen te worden aangepast of verwijderd. Vertalingen met grof of informeel taalgebruik worden meestal rood of oranje gemarkeerd.
Er zijn geen resultaten gevonden voor deze term.
Synoniemen voor its complementary sequence in het Engels